Size/Line Capacity The size of your reel should match the species youre chasing and your style of fishing
From: Trey: Texas 7/28/17 Comments: I have been using this braid for quite some time now

cDNA DKFZp761E0323 (from clone DKFZp761 E 161F3 1708 2371 NM_024045 Hs.7392 0 1 hypothetical protein MGC3199 (MGC3199), mRNA 195E1 1107 1362 NM_022736 Hs.7503 1.00E-129 1 hypothetical protein FLJ14153 (FLJ14153), mR 137F5 59 666 NM_018491 Hs.7535 0 2 COBW-like protein (LOC55871), mRNA /cds=(64,9 597E1 2302 2893 AF126028 Hs.7540 0 2 unknown mRNA /cds=(0, 1261 ) /gb=AF126028 /gi= 473B6 3006 3302 AK025615 Hs.7567 1.00E-158 1 cDNA: FLJ21962 fis, clone HEP05564 /cds=UNKNOW 519H1 232 720 BG112505 Hs.7589 0 602282107F1 cDNA, 5' end /clone=IMAGE:4369729 73A9 106 3912 M20681 Hs.7594 0 8 glucose transporter-like protein-Ill (GLUT3), compl 51 D3 106 3200 NM_006931 Hs.7594 0 2 solute carrier family 2 (facilitated glucose t 596E8 1512 1748 M94046 Hs.7647 1.00E-129 2 zinc finger protein (MAZ) mRNA /cds=UNKNOWN /gb=M9404 472A8 1575 1983 NM_004576 Hs.7688 0 1 protein phosphatase 2 (formerly 2A), regulator 191A10 386 889 NM_007278 Hs.77 9 0 3 GABA(A) receptor-associated protein (GABARAP 459C4 5636 5897 AB002323 Hs.7720 2.00E-87 1 mRNA for KIAA0325 gene, partial eds /cds=(0,6265) /gb 99A12 606 1253 NM J18453 Hs.7731 0 1 uncharacterized bone marrow protein BM036 (BM 72G8 5806 6409 AB007938 Hs.7764 0 5 for KIAA0469 protein, complete eds /cds=( 45G2 6168 6404 NM_014851 Hs.7764 1.00E-132 1 KIAA0469 gene product (KIAA0469), mRNA /cds=( 172A4 371 588 NM_007273 Hs.7771 1.00E-107 1 B-cell associated protein (REA), mRNA /cds=(9 177B8 2055 2431 AK023166 Hs.7797 0 1 FLJ13104 fis, clone NT2RP3002343 /cds=(28 99B6 865 1244 NM_012461 Hs.7797 0 1 TERF1 (TRFI)-interacting nuclear factor 2 (T 160G8 727 860 U94855 Hs.7811 5.00E-66 1 translation initiation factor 347 kDa subunit 54G6 1 1007 AK001319 Hs.7837 1.00E-148 3 FLJ10457 fis, clone NT2RP1001424 /cds=UN 594A7 1295 1793 NM_013446 Hs.7838 0 4 makorin, ring finger protein, 1 (MKRN1), mRNA 188A12 1 2013 NM_017761 Hs.7862 0 3 hypothetical protein FLJ20312 (FLJ20312), mR 594A2 3060 3588 A 023813 Hs.7871 0 2 cDNA FLJ13751 fis, clone PLACE3000339, weakly 124C12 472 1251 NM_001550 Hs.7879 0 1 interferon-related developmental regulator 147A8 1381 1711 Y10313 Hs.7879 1.00E-134 1 for PC4 protein (IFRD1 gene) /cds=(219,158 Table 3A, Candidate nucleotide sequences identified using differential cDNA hybridization analysis 74H3 4430 4978 AF302505 Hs.7886 0 2 pellino 1 (PELI1) mRNA, complete eds /cds=(4038 71 G3 473 1112 NM_016224 Hs.7905 0 2 SH3 and PX domain-containing protein SH3PX1 (S 52C7 1637 2231 AB029551 Hs.7910 0 1 YEAF1 mRNA for YY1 and E4TF1 associated factor 177H5 5411 6045 AB002321 Hs.7911 0 1 KIAA0323 gene, partial eds /cds=(0,2175) /gb 114C8 1678 3078 NM_017657 Hs.7942 1.00E-149 2 hypothetical protein FLJ20080 (FLJ20080), mR 169D8 1453 2158 AK001437 Hs.7943 0 1 FLJ10575 fis, clone NT2RP2003295, highly 599G8 618 1204 NM_003796 Hs.7943 0 1 RPB5-mediating protein (RMP), mRNA /cds=(465, 127E11 107 796 NM_016099 Hs.7953 0 3 HSPC041 protein (LOC51125), mRNA /cds=(141 ,45 98D6 4769 6506 NM_001111 Hs.7957 0 2( adenosine deaminase, RNA-specific (ADAR), tr 37H10 2479 6594 X79448 Hs.7957 0 8 IFI-4 mRNA for type I protein /cds=(1165,3960) /g 178G4 4209 5132 AB028981 Hs.8021 0 4 mRNA for KIAA1058 protein, partial eds /cds=(0 118E9 630 1688 NM_006083 Hs.8024 0 2 IK cytokine, down-regulator of HLA II (IK), mRN 171A8 1658 1973 AK002026 Hs.8033 1.00E-151 1 FLJ11164 fis, clone PLACE1007226, weakly 103G5 1504 1977 NM_018346 Hs.8033 0 1 hypothetical protein FLJ11164 (FLJ1116 ), mR 179G7 2860 3032 AK022497 Hs.8068 6.00E-46 1 FLJ12435 fis, clone NT2RM1000059 /cds=(88 594A11 2327 2658 NM_018210 Hs.8083 1.00E-167 1 hypothetical protein FLJ10769 (FLJ10769), mR 103B5 1968 2448 AF267856 Hs.8084 0 1 HT033 mRNA, complete eds /cds=(203,931 ) /gb=A 98E4 1367 1808 AF113008 Hs.8102 0 7 clone FLB0708 mRNA sequence /cds=UNKNOWN /gb= 191H10 4581 5819 NM_018695 Hs.811 0 3 erbb2-interacting protein ERBIN (LOC55914), 99F1 550 2672 AB014550 Hs.8118 0 4 mRNA for KIAA0650 protein, partial eds /cds=(0 165H11 488 663 NM_024408 Hs.8121 3.00E-93 1 Notch (Drosophila) homolog 2 (NOTCH2), mRNA / 515C7 2188 2514 AL050371 Hs.8128 1.00E-114 1 mRNA

Well it never seemed to help me much, but these days the sonar and depth imaging technology has come so far that its really possible to up your game with a nice fish finder
Contains a 60S AGGTATCTGAGGCACTGCTCACCT Ribosomal Protein L35A LIKE pseudogene, a gene coding for a 60S Ribosomal Protein L12 LIKE protein in an intron of the HSET gene coding for a Kinesin related protein, the PHF1 (PHF2) gene coding for alternative splice products PHD finger proteins 1 and 2, the gene coding for five different alternatively spliced mRNAs coding for a protein similar to CYTA (CYCY) and identical to a polypeptide coded for by a known patented cDNA, and the first two exons of the gene coding for the homolog of the rat synaptic ras GTPase- activating protein p135 SynGAP